Comparative sequence analysis how to#

Genome browser designers consider realigning.Users forewarned about regions of interest.Which Alignment Columns to Trust?(with Amol Prakash, generalizing Karlin and Altschul 1990) Goal: label each alignment column with confidence measure of alignment correctness Recent comparison (Margulies et al., 2007) of 4 whole-mammal alignment methods revealed widespread disagreement.Vertebrate alignment has 3.8 billion columns.Search for regions of well conserved alignment.Use whole-genome multiple alignment such as provided by UCSC Genome Browser.Multiple Sequence Alignment AC-TAACCGGGAGATTTCAGA human AAGTT-CCGGGAGATTTCC-Achimp TAGTTATCCGGGAGATT-AGAmouse AA-AACCGGTAGATTTCAGGrat (Finding the optimal alignment is NP-complete.)

Comparative sequence analysis how to#

How to Find Conserved Motifs ACTAACCGGGAGATTTCAGAhuman AAGTTCCGGGAGATTTCCAchimp TAGTTATCCGGGAGATTAGAmouse AAAACCGGTAGATTTCAGGrat Identify unusually well conserved subsequences (i.e., ones that have not mutated much over the course of evolution): “motifs”.Consider a set of corresponding DNA sequences from related species.Functional regions of DNA (regions under “purifying constraint”) evolve slower than nonfunctional ones.Fertile ground for comparative genomicsġ982-2003: number of nucleotides in GenBank doubled every 18 months Since 2003: doubled every 3 years.1025 bacterial genomes sequenced (as of ).46 vertebrate genomes sequenced (primates to rodents to marsupials to birds to fishes).Lab benchwork is costly and time-consuming.How can we understand the genome’s program?.How Much DNA in a Cell? An organism’s genome is the total DNA in one of its cells. FootPrinter: phylogenetic footprinting without alignmentĭNA: the cell’s program Cell DNA Nucleotide (A, C, G, or T)ĭNA TCCAACGGTGCTGAGGTGCAC Protein Gene DNA, Genes, and Proteins DNA: program for cell processes Proteins (and RNA): execute cell processes.Which parts of multiple sequence alignments are trustworthy?.Phylogenetic footprinting by multiple sequence alignment.Comparative Sequence Analysisin Molecular Biology Martin Tompa Computer Science & Engineering Genome Sciences University of Washington Seattle, Washington, U.S.A.